الفهرس 
IntroductionOnly 14 pages are availabe for public view
 |  | from | 137 |  |  |
| | | from | 137 | | |
Abstract
Beta-Lactam antibiotics are the most commonly used antibacterial agents in the present chemotherapeutic armamentarium. Production of β-lactamase is the most common resistance mechanism against β- lactam antibiotics in gram-negative bacteria. These enzymes hydrolyze the β-lactam ring of all classes of β-lactam antibiotics, thus inactivating the drug. β-lactamases had been in observed in bacterial strains long before penicillin was available for use in the treatment of bacterial infections. The catalytic function of β-lactamases is the primary cause of resistance to β-lactam antibiotics. These enzymes hydrolyze the β-lactam ring of these versatile antibiotics, which is a process that inactivates the drugs. Over the last 20 years many new β-lactam antibiotics have been developed that were specifically designed to be resistant to hydrolysis by β-lactamases. However, with each new class of β-lactam antibiotics that has been used to treat patients, new β-lactamases have emerged that caused resistance to that drug. Beta-lactam derivatives, Sodium cefotaxime, Ceftazidime pentahydrate, and Ceftriaxone disodium were analyzed by Ultraviolet-Visible Spectroscopy, High-performance liquid chromatography (HPLC), Melting Point, Mass spectrometry (MS) , and Nuclear Magnetic Resonance (NMR). Cefotaxime gave results : UV spectral data : max (nm) : 233, High performance liquid chromatographic (HPLC): Rf values : 2.562 min, Melting Point: 162 – 163 °C, ESI-MS : [M-H]- = m/z : 477.5, Infrared Spectroscopy (IR): cm-1 NH stretch 3430, 3347(s,br), Aliphatic C-H stretch 2983(m), C=O(lactam) stretch 1760(s), C=O(carboxylic ester) 1729(s), C=O(amide stretch 1647(s), C=C, C=N stretch 1610, 1536(s), Aliphatic C-H bend 1386, 1355(s), C-O stretching 1062(s), Nuclear Magnetic Resonance (NMR) 1H NMR: 1H NMR data : d (ppm) : 7.25(s, H1), 6.73(s, H3), 3.84(s, H6), 9.53(d, H8, J=0.9), 5.59(dd, H9, J=1.8), 5.1(d, H10, J=2.5), 3.2, 3.47(q, H12, J=1.1, 2.2), 4.77, 4.97(q, H16, J=1.7, 1.9), 8(s, H18), 13C NMR: 13C NMR data: d (ppm): 21.26(C18), 25.9(C12), 57.9(C16), 58.6(C10), 62.4(C6), 64.9(C9), 109.6(C3), 113.5(C13), 135.0(C14), 143.0(C4), 149.5(C5), 162.9(C2), 163.5(C17), 165.0(C15), 169.1(C7), 171.0(C11). Ceftazidime gave results : UV spectral data : max (nm) : 237, High performance liquid chromatographic (HPLC) : Rf values: 2.872 min, Melting Point : 145 – 148 °C, ESI-MS: [M-H]-= m/z : 636.6, Infrared Spectroscopy (IR): cm1 3250, 1700, 1540, 1490, 1160, 680, Nuclear Magnetic Resonance (NMR) 1H NMR: d (ppm) : 7.22(s, H1), 6.92(s, H3), 3.3(q, H8, J=3.5, 3.5), 3.4(q, H9, J=3.3, 3.2), 5.5(dd, H12, J=2.1), 3.5(s, H15), 5.5(s, H19), 9.5(pyridinium), 13C NMR : d (ppm) : 39.8(C8), 40.0(C9), 40.1(C19), 40.3(C12), 58.0(C15), 62.4(C6), 109.5(C3), 116.2(C16), 143(C4), 149.5(C5), 153.8(C7), 161.1(C13), 162.7(C2), 163.5(C18), 164.8(C10), 169.0(C14). Ceftriaxone gave results: UV spectral data in MeOH : max (nm) : 233, High performance liquid chromatographic (HPLC) : Rf values : 3.383 min, Melting Point : 155 °C, ESI-MS : [M-H]-= m/z : 554.6, Infrared Spectroscopy (IR): cm-1 3400, 2800, 1700, 1650, 1600, 1380, Nuclear Magnetic Resonance (NMR): 1H NMR data: d (ppm) : 2.4(s, H16), 3.0, 3.4(d, H12, J=1.1, 0.9), 3.8(s, H6), 5.2(, H10, J=0.8), 5.6(dd, H9, J=1.1), 6.6(s, H3), 7.2(sH1), 8.0(d, H8, J=1.5),8.5(q, H19, J=1.3), 9.3(d, H8, J=2.1), 13C NMR : 13C NMR data : d (ppm): 24.5(C18), 25.0(C12), 25.4(C20), 39.8(C21), 39.9(C17), 57.9(C16), 59.0(C10), 61.9(C6), 83.1(C9), 110.2(C3), 128.5(C13), 138.4(C14), 143.4(C4), 145.5(C5), 146.1(C2), 150.0(C15), 163.9(C7), 168.9(C11). A total of 281 bacterial strains were tested against Cefotaxime, Ceftriaxone, and Ceftazidime ; using broth microdilution MIC Method (DADE BEHRING, USA), 97 bacterial strains were resistant to all of these antibiotics. The resistant bacterial strains were identified as 50 E.coli and 47 as Klebsiella pneumoniae using biochemical identification tests (DADE BEHRING, USA). Nitrocefin test and Double Disc test for detection of beta-lactamase showed that 80 strains were positive, while 17 isolates were negative. Extraction of DNA from these strains was performed in the first step for the detection of TEM and SHV β-lactamase genes by polymerase chain reaction (PCR). The following oligonucleotide primers specific for the SHV genes, A [5’-(CACTCAAGGATGTATTGTG)-3’] and B [5’-(TTAGCGTTGCCAGTGCTCG)-3’] corresponding to nucleotide numbers 103 to 121 and 988 to 970, respectively; for TEM genes, C [5’-(TCGGGGAAATGTGCGCG)-3’] and D [5’-(TGCTTAATCAGTGAGGCACC)-3’] corresponding to nucleotide numbers 90 to 105 and 1062 to 1042, respectively. Primers A and B amplified an 885-bp fragment, while primers C and D amplified an 971-bp fragment. The strains were divided into five groups according to the presence of beta-lactamase enzymes or genes. All the strains in group (I) (8 strains) were positive for Nitrocefin test, Double Disc test, TEM gene, and SHV gene; in group (II) (27 strains) all tests were positive except for SHV gene; while in group (III) (28 strains) all tests were positive except for TEM gene; in group (IV) (17 strains) only Double Disc and Nitrocefin Test were positive; and finally, all strains in group (V) (17 strains) were negative for all tests.